Stories
Slash Boxes
Comments
NOTE: use Perl; is on undef hiatus. You can read content, but you can't post it. More info will be forthcoming forthcomingly.

All the Perl that's Practical to Extract and Report

use Perl Log In

Log In

[ Create a new account ]

TorgoX (1933)

TorgoX
  sburkeNO@SPAMcpan.org
http://search.cpan.org/~sburke/

"Il est beau comme la retractilité des serres des oiseaux rapaces [...] et surtout, comme la rencontre fortuite sur une table de dissection d'une machine à coudre et d'un parapluie !" -- Lautréamont

Journal of TorgoX (1933)

Saturday June 15, 2002
12:56 AM

TGAAGATTCAGTTTTCACTTAAACAACCAGCAAGTCTTGAAGTCTCTTCCCAAGCAAATG

[ #5673 ]
Dear Log,

TGAAGATTCAGTTTTCACTTAAACAACCAGCAAGTCTTGAAGTCTCTTCCCAAGCAAATG GGAGCTTCTTTGGACCTTGGAGCACACAGAGGATTCTACTTTCTTTAAAACTTTGTTTTC AGGCAATTTCCCTGAGAACCGTTTACTTCCAGAAGATTGGTGGAGCTTGATCTGAAGGCT GGCCATGAAATCTCAAGGTCAACATTGGTATTCCAGTTCAGATAAAAACTGTAAAGTGAG CTTTCGTGAGAAGCTTCTGATTATTGATTCAAACCTGGGGGTCCAAGATGTGGAGAACCT

And that's not the half of it!

I've been doing a wee bit of screen-scraping from genome databases. It's a wonderful challenge. Almost a worse-case scenario in how bad screen-scraping can get.

The Fine Print: The following comments are owned by whoever posted them. We are not responsible for them in any way.
 Full
 Abbreviated
 Hidden
More | Login | Reply
Loading... please wait.